During asexual reproduction, the genetic material of the parent is passed on to the offspring by
a. homologous pairing.
b. meiosis and fertilization.
c. mitosis and cytokinesis.
d. karyotyping.
e. chiasmata.
Ans: c. mitosis and cytokinesis.
You might also like to view...
With respect to RNA processing, which of the following is false?
A) It leads to the production of alternative gene products. B) Some introns are removed by spliceosomes. C) Some introns are self-splicing. D) Prokaryotic mRNAs are polyadenylated at the 3' end. E) Chemical modification occurs with tRNA transcripts.
The function of chloroplasts is
A) cellular respiration. B) lipid synthesis. C) photosynthesis. D) intracellular digestion.
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? A) two B) three C) four D) five
Speciation without geographic isolation is called ________ speciation
A) sympatric B) allopatric C) incomplete D) diversifying