Which of the following statements is consistent with the principle of competitive exclusion?
A) Bird species generally do not compete for nesting sites.
B) The random distribution of one competing species will have a positive impact on the population growth of the other competing species.
C) Two species with the same fundamental niche will exclude other competing species.
D) Even a slight reproductive advantage will eventually lead to the elimination of the less well adapted of two competing species.
E) Natural selection tends to increase competition between related species.
Answer: D
You might also like to view...
Referring to the image above, what is the amino acid sequence that is coded for by the DNA sequence
GATGGACTTGAAGAGTGGTAA?
a. asp-gly-val-glu-glu-trp-tyr b. leu-pro-glu-leu-leu-thr-ile c. ile-thr-leu-leu-gly-pro-leu d. ser-arg-arg-met-gly-val-stop e. met-gly-val-lys-ser-gly-stop
The biological macromolecule that is least soluble in water is a(n):
A. nucleic acid. B. protein. C. carbohydrate. D. lipid. E. enzyme
Which of these processes of viral multiplication is most likely to damage the host cell?
a. Release of nonenveloped viruses b. Uncoating c. Reverse transcription of retroviral RNA d. Release of enveloped viruses e. Viral entry into host cells by fusion
What would be an easy way to determine if a skull is a mammal's skull?
A. Examine the teeth. B. Look for the remains of the tympanum. C. Look for air sacs in the skull. D. Measure the brain case volume.