Why is it so difficult to identify the beginnings of the hominin line? What will be an ideal response?
ANSWER: To be a hominin, there are number of defining features. Some leave a decent fossil record,
such as flat face and small canine teeth. Unfortunately, one defining feature of hominins is
upright walking. Many of the ancient skeletons are incomplete and thus it is very difficult to
determine if they were truly and regularly bipedal.
You might also like to view...
Because most herbivores do not produce cellulase, they have specialized compartments in their digestive tracts that (select all correct choices):
A. provide appropriate temperature and pH for breaking down plant material. B. house large populations of bacteria and other single-celled symbionts that do produce cellulase. C. grind up the plant material using muscular gizzards or other structures. D. secrete alternative enzymes that carry out the same function as cellulase. E. ferment nutrients in the hindgut.
Which of the following sequences contain a six-nucleotide inverted repeat?
A. GTCACGCGACGATACGGTCACG B. GTCACGACTAGCCTAGTCGCTG C. GTCACGACTAGCCATCAGCCTG D. GTCACGACTAGCCCGACTAGTG
A deletion in an operon removes the promoter. How will that affect the transcript that is produced from the operon?
A. The transcript will be produced and normal in length B. The transcript will be produced, but shorter than normal C. The transcript will be produced, but longer than normal D. The transcript will produced, but will contain a deletion E. The transcript will not be produced
Shallow seas covered much of the land during the:a
Silurian period. b. Precambrian period. c. Ordovician period. d. Triassic period. e. Oligocene epoch.