A good hypothesis must:
A) be theoretical.
B) be true.
C) be false.
D) be falsifiable.
E) lead to a question.
Answer: D
You might also like to view...
Transformation is defined as the:
a. change of the bacterial genotypes through the exchange of DNA from one cell to another. b. internal change in the original nucleotide sequence of a gene or genes within an or-ganism's genome. c. process by which genetic elements such as plasmids and transposons excise from one genomic location and insert into another. d. uptake of free DNA from the environment and recombination with the recipient's homologous DNA.
Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred?
Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition-silent B. base addition-none C. base addition-missense D. base addition-nonsense E. base addition-frameshift
The work of (Needham/Redi/Spallanzani) using infusions in sealed vials provided strong evidence that spontaneous generation does not occur
What will be an ideal response?
This molecule of starch is different from a glucose molecule in that this molecule
A. is used by cells for long-term storage and release of energy for cell functions.
B. is a complex carbohydrate polymer.
C. has the same characteristics of glucose.
D. is used by cells for quick release of energy for cell functions.
E. can provide structure for cells that contain it.