The most common hypersensitivity reaction is:
a. Type I
b. Type II
c. Type III
d. Type IV
ANS: A
You might also like to view...
Which of the following fragments would be generated when the following sequence is cut by SmaI?
5? TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3? A. One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment B. One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment C. Two 19 bp fragments D. One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment
Heart transplants are the MOST common organ transplant in the United States
A) True B) False
An individual patient can add information him/herself to which health data management tool?
A. Provider electronic health record B. Patient portal C. Integrated delivery record D. Personal health record
All of the following chemotherapy medications are used for Hodgkin's lymphoma, except?
A) ?cyclophosphamide. B) ?dacarbazine. C) ?bleomycin. D) ?vinblastine.