Does ADP contain the capacity to provide energy for the cell?

A. No. ADP does not contain any bonds that can be broken to provide energy for the cell.
B. Yes. ADP has the same capacity to provide energy for the cell as ATP.
C. Yes. Cleaving the bond between the ribose sugar and the two phosphate groups can provide energy for the cell.
D. Yes. Cleaving the bond between the terminal phosphate and the phosphate attached to the ribose sugar can provide energy for the cell.


D

Biology & Microbiology

You might also like to view...

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?

Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition - silent B. substitution - missense C. base addition - missense D. substitution - nonsense E. base addition-frameshift

Biology & Microbiology

Systematics is:

a. the study of naming and assigning organisms. b. the evolutionary history of a specific organismal group. c. the study of the diversity of life to understand its evolutionary history. d. the practice of arranging organisms into a hierarchy. e. All of the above are correct.

Biology & Microbiology

An important indicator of evolutionary relatedness is to determine:

a. size of the periplasmic space b. similarities of cell membrane proteins c. size of the bacterial chromosome d. nitrogen base sequence of rRNA e. size of the ribosomes

Biology & Microbiology

The mechanism of sympatric speciation has been verified in hemp nettles by:

a. creating unique hybrids under laboratory conditions. b. producing hybrids that were 98% fertile under laboratory conditions. c. producing experimental hybrids that formed fertile offspring with the naturally occurring hybrid. d. producing experimental hybrids that could reproduce successfully with both parent species. e. creating hybrids that reproduced through the F4 generation before dying from hybrid inviability

Biology & Microbiology