Substrate-level phosphorylation occurs during which of the following stage(s) of glucose catabolism?
A) formation of acetyl-CoA
B) lysis stage of glycolysis
C) energy-conservation stage of glycolysis
D) Krebs cycle
E) formation of acetyl-CoA and the Krebs cycle
C
Bloom's Taxonomy: Application
Section: Carbohydrate Catabolism
Learning Outcome: 5.3, 5.8, 5.9
You might also like to view...
Intermediates from the Krebs cycle can be converted to amino acids by the process of ________.
A. beta oxidation B. gluconeogenesis C. phosphorylation D. deamination E. amination
Protective membranes called meninges surround the spinal cord as well as the _________
Fill in the blank(s) with the appropriate word(s)
Most of the enzymes within living things are proteins. Located on the enzyme structure is an area that binds to the substance it acts upon. What is that location called?
A) substrate B) active site C) connection point D) reactant location
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide??Normal gene: ATGGCCGGCCCGAAAGAGACCMutated gene: ATGGCCGGCACCGAAAGAGACC?Normal protein: Met-Ala-Gly-Pro-Lys-Glu-ThrMutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
A. base addition-frameshift B. substitution-nonsense C. base addition-missense D. substitution-missense E. base addition-silent