Translation of RNA into proteins occurs
A) in the nucleus.
B) in the endoplasmic reticulum.
C) in the cytoplasm.
D) in both the nucleus and the cytoplasm.
E) in both the nucleus and the endoplasmic reticulum.
C
You might also like to view...
The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification
ATGAAAGCAATTTCCGTACTGAAAGGTTGGTGGCGCACTTCCTGA wild type leader peptide coding sequence ATGAAAGCAATTTCCGTACTGAAAGGTGGGTGGCGCACTTCCTGA mutant leader peptide coding sequence What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type? A. The Trp repressor will bind more tightly to the trp operon in the mutant cells. B. The amount of attenuation will be reduced in the mutant. C. Negative control of the trp operon will be increased in the mutant. D. Open promoter complexes will form less often in the mutant.
You would expect water derived from the synthesis of ATP to be especially important for
A. small desert dwelling animals. B. rain forest amphibians. C. arctic mammals. D. sea birds. E. marine mammals.
All stem cells ____
a. are differentiated cells that proliferate indefinitely b. can differentiate into any cell type, but can only divide once after terminally differentiating c. have the ability to differentiate into all cell types d. are undifferentiated cells that proliferate indefinitely e. are undifferentiated cells that proliferate a finite number of times
Even in the absence of sperm, metabolic activity in an egg can be artificially activated by _____
A) abnormally high levels of carbonic acid in the cytosol B) abnormally low levels of extracellular oxygen C) injection of calcium ions into the cytosol D) depletion of its ATP supplies