The category of pharmacologic activity for furosemide is ________.

A. bronchodilator
B. diuretic
C. hypnotic
D. analgesic
E. anticonvulsant


Answer: B

Health Professions

You might also like to view...

How are values assigned using the payment methodology called the Relative Value Scale (RVS)?

a. By geographic region b. By population density c. By weather patterns d. By rate of malpractice cases

Health Professions

A behavior disorder characterized by relatively rapid onset of widely disorganized thought is:

A) dementia. B) delirium. C) delusions. D) disassociation.

Health Professions

How does von Willebrand's disease (VWD) differ from Bernard-Soulier syndrome? Correlate the pathophysiology of both disorders in your response. Name at least two laboratory tests that differentiate each

What will be an ideal response?

Health Professions

Which of the following fragments would be generated when the following sequence is cut by SmaI?

5? TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3? A. One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment B. One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment C. Two 19 bp fragments D. One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment

Health Professions