If your parents are heterozygous for a gene, what is the chance that you will have at least one copy of it?
A) 0%
B) 25%
C) 50%
D) 75%
D
You might also like to view...
A ________ epidemic is characterized by a sharp rise to a peak then a rapid, but not as pronounced, decline in the number of individuals infected.
A. common-source B. sporadic C. herd D. propagated
Referring to the image above, what is the amino acid sequence that is coded for by the DNA sequence
GATGGACTTGAAGAGTGGTAA?
a. asp-gly-val-glu-glu-trp-tyr b. leu-pro-glu-leu-leu-thr-ile c. ile-thr-leu-leu-gly-pro-leu d. ser-arg-arg-met-gly-val-stop e. met-gly-val-lys-ser-gly-stop
Which system involves plasma proteins activated
when an organism’s pattern receptors become bound to anything? a. cytokine b. complement c. suppressor d. enhancer e. coagulation
A type of horizontal gene transfer in prokaryotes in which a cell receives DNA from another cell through sex pili is:
a. Transformation b. Replication c. Transduction d. Conjugation e. Fixation