Which organelle would you expect to find in plant cells but not animal cells?
A. mitochondrion
B. ribosome
C. chloroplast
D. smooth endoplasmic reticulum
Ans: C. chloroplast
You might also like to view...
What is the function of signal transduction?
What will be an ideal response?
The allele for sickle cell anemia is maintained in populations by frequency dependent selection
_______________ Indicate whether the statement is true or false.
To observe the three-dimensional structure of a cell the best type of microscopy would be
A. scanning electron microscopy. B. fluorescence microscopy. C. standard light microscopy. D. differential-interference light microscopy. E. transmission electron microscopy.
You have the target DNA and primers shown below. You add the target DNA and primers, along with dATP, dTTP, dGTP, dCTP and Taq DNA polymerase to a test tube. After 30 cycles of PCR, which of the following is true about the DNA in your test tube?Target DNA: 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'Primer 1: 5' - GATCAA - 3'Primer 2: 5' - CGGAAA - 3'
A. There will be around a billion DNA molecules and most will look just like the template 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. B. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'. C. Only the template and primers will be present; since no DNA helicase was added the strands won't separate so no new DNA can be made. D. There will be around a billion DNA molecules and most will be single stranded, either 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' OR 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. E. There will be around a million DNA molecules of various sizes, depending on where chain termination occurred.