Which organelle would you expect to find in plant cells but not animal cells?

A. mitochondrion
B. ribosome
C. chloroplast
D. smooth endoplasmic reticulum


Ans: C. chloroplast

Biology & Microbiology

You might also like to view...

What is the function of signal transduction?

What will be an ideal response?

Biology & Microbiology

The allele for sickle cell anemia is maintained in populations by frequency dependent selection

_______________ Indicate whether the statement is true or false.

Biology & Microbiology

To observe the three-dimensional structure of a cell the best type of microscopy would be

A. scanning electron microscopy. B. fluorescence microscopy. C. standard light microscopy. D. differential-interference light microscopy. E. transmission electron microscopy.

Biology & Microbiology

You have the target DNA and primers shown below. You add the target DNA and primers, along with dATP, dTTP, dGTP, dCTP and Taq DNA polymerase to a test tube. After 30 cycles of PCR, which of the following is true about the DNA in your test tube?Target DNA:        5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'Primer 1:                5' -  GATCAA - 3'Primer 2:                5' -  CGGAAA - 3'

A. There will be around a billion DNA molecules and most will look just like the template 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. B. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'. C. Only the template and primers will be present; since no DNA helicase was added the strands won't separate so no new DNA can be made. D. There will be around a billion DNA molecules and most will be single stranded, either 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'  OR 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'.  E. There will be around a million DNA molecules of various sizes, depending on where chain termination occurred.

Biology & Microbiology