Which is the first eon for which there is evidence of life?
A. Archean eon
B. Proterozoic eon
C. Stromatolite eon
D. Hadean eon
E. Phanerozoic eon
Answer: A
You might also like to view...
The theory of chromosomal inheritance was first proposed by
A. Mendel. B. Morgan. C. Knight. D. Sutton. E. Stern.
You may have heard the advice to “eat low on the food chain.” Explain how choosing a soybean-protein “burger” rather than a beef burger for lunch is energy efficient with respect to energy flow and utilization in trophic levels.
What will be an ideal response?
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? A) two B) three C) four D) five
What is the color of light that chlorophylls absorb that has the highest energy?
A. green B. violet-blue C. red D. yellow-orange