Which is the first eon for which there is evidence of life?

A. Archean eon
B. Proterozoic eon
C. Stromatolite eon
D. Hadean eon
E. Phanerozoic eon


Answer: A

Biology & Microbiology

You might also like to view...

What is the color of light that chlorophylls absorb that has the highest energy?  

A.  green B.  violet-blue C.  red D.  yellow-orange

Biology & Microbiology

The theory of chromosomal inheritance was first proposed by  

A.  Mendel. B.  Morgan. C.  Knight. D.  Sutton. E.  Stern.

Biology & Microbiology

You may have heard the advice to “eat low on the food chain.” Explain how choosing a soybean-protein “burger” rather than a beef burger for lunch is energy efficient with respect to energy flow and utilization in trophic levels.

What will be an ideal response?

Biology & Microbiology

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? A) two B) three C) four D) five

Biology & Microbiology