Protists that have two nuclei are classified as
A) amoebas.
B) diplomonads.
C) parabasalids.
D) apicomplexans.
E) ciliates.
B
You might also like to view...
Which of the following is (are) true about cephalosporins?
A. They, like penicillin, inhibit bacterial cell wall synthesis. B. They can be given to patients with penicillin allergies. C. There are four generations of cephalosporins. D. All of the choices are correct.
The adult worm of Fasciola measures 2 to 5 cm by 0.8 to 1.3 cm with a cephalic cone at the anterior end that contains the oral sucker. The drug of choice to treat Fasciola infections is:
a. praziquantel. b. triclabendazole. c. albendazole. d. benzimidazole.
What phenomena is thought to bring nutrients to Atolls?
a. Upwelling b. Algal ridges c. Run-off d. Settling of sediments
The sequence of gene B from another baby frog who is homozygous for allele b2 is shown. What effect does the mutation in allele b2 have on the protein?
5? AGGTCGCATAAATGTTCCTGTAATTTGG… 3? A) Allele b2 has a frameshift mutation—a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on. B) Allele b2 has a deletion of one nucleotide outside of the coding region and there is no effect on the protein. C) Allele b2 has a missense mutation—a nucleotide substitution that changes one amino acid to another. D) Allele b2 has a nonsense mutation—a nucleotide substitution that forms a stop codon. E) Allele b2 has a silent mutation—a nucleotide substitution that does not change the protein.