Cyanobacteria Phototrophy
What will be an ideal response?
•Combines key features of PSI and PSII.
-the cycle for a single electron is shown
-four electrons (4e-) cycle per O2 photolyzed
-two electrons (2e-) cycle per NADP+->NADPH
-Feredoxin-NAD+ reductase
You might also like to view...
Which plant organelle stores solutes and plays a major role in maintaining turgor pressure?
a. nucleus b. cell wall c. chloroplast d. vacuole e. mitochondrion
The sequence of gene B from another baby frog who is homozygous for allele b2 is shown. What effect does the mutation in allele b2 have on the protein?
5? AGGTCGCATAAATGTTCCTGTAATTTGG… 3? A) Allele b2 has a frameshift mutation—a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on. B) Allele b2 has a deletion of one nucleotide outside of the coding region and there is no effect on the protein. C) Allele b2 has a missense mutation—a nucleotide substitution that changes one amino acid to another. D) Allele b2 has a nonsense mutation—a nucleotide substitution that forms a stop codon. E) Allele b2 has a silent mutation—a nucleotide substitution that does not change the protein.
The Dall sheep (a) curve represents which type of survivorship curve?
A) Type I B) Type II C) Type III D) Type IV
Which respiratory structure likely has the largest surface area for gas exchange to occur?
A) the body surface of a worm B) the lungs of a pig C) the tracheal system of a house fly D) the gills of a trout