Our ability to respond to moderate heat and cold is due to
A. mechanoreceptors.
B. thermoreceptors.
C. nociceptors.
D. electromagnetic receptors.
E. chemoreceptors.
B. thermoreceptors.
You might also like to view...
Which scientist(s) discovered the basis for the
base-pair rule, which stated that the amounts of adenine in all DNA are the same, as are the amounts of cytosine and guanine?
a. Watson and Crick b. Beadles c. Chargaff d. Franklin e. Pauling
Ecdysone, or chemicals that mimic ecdysone, are sometimes used as ____
a. insecticides b. fungicides c. herbicides d. fungicides and nematocides e. fertilizers
When a sudden change in the environment, such as a flood or fire, reduces the size of a population, the survivors' collective gene pool will be only a limited representation of what was present before the disaster. This phenomenon is called:
a) the Hardy-Weinberg effect. b) the genetic load. c) the founder effect. d) the bottleneck effect. e) the mutation effect.
You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -GTTAG -3' and 5' -ATCCC -3'. C. 3' -CAATC- 5' and 3' -GCCCT- 5'. D. 5' -CAATC- 3' and 5' -GCCCT- 3'. E. 3' - AGGGC- 5' and 3' -GATTG- 5'.