During sexual arousal, the _____ secrete a small amount of a clear alkaline fluid, which appears as droplets at the tip of the penis before ejaculation occurs.
A. vas deferens
B. seminal vesicles
C. Cowper's glands
D. interstitial cells.
C. Cowper's glands
You might also like to view...
Riboswitches are alternative RNA structures mediated by the binding of molecules to the RNA. One example of a riboswitch is the intrinsic terminator hairpin (stem-loop) structure that may form in specific sites of newly transcribed RNA
This stable RNA hairpin, if followed by 4–8 uridine residues at the 3' end, is a signal for transcriptional termination of that RNA. The termination of transcription involves interactions of the RNA polymerase, the hairpin, and the template strand sequence. RNA polymerase reads the DNA template strand 3' to 5' while synthesizing the new (nascent) RNA strand 5' to 3'. Which of the following DNA sequences, when transcribed, will most likely form an intrinsic transcription termination RNA structure? A. 3' AAAAAAUUUUUU TTTTT 5' B. 3' ACCCCCATGGGGGAAAAAA 5' C. 3' GGGGGGTTTCCCCCTTTTTT 5' D. 3' ACGACCCGGACGGGGGGG 5' E.3' TTTTTTCCCCCCAAAGGGGGG 5'
Would ID50 and LD50 necessarily be the same for a given virus? Why or why not?
A. Yes, because the number of viruses that infect 50% of a test population should also kill 50% of that test population. B. No, because a virus may be highly infectious (very low ID50 value) but only marginally lethal (very high LD50 value). A prime example of this is the rhinovirus (common cold virus). C. No, because very few viruses are lethal, yet many are highly infectious. The two values should ALWAYS be different. D. Yes, because what we're actually describing here is infection/killing of individual CELLS, not of entire organisms. If a cell is infected, it will always be killed.
If you observed a group of animals for several weeks and only saw them eat dead and decaying matter, you would classify them as
A. omnivores. B. carnivores. C. detritivores. D. herbivores. E. insectivores.
All of the following may have been in the atmosphere of primitive Earth EXCEPT
A. hydrogen. B. ammonia. C. water. D. oxygen.