Adenoviruses are a frequent cause of acute upper respiratory tract infections in humans. Adenoviruses have a genome composed of double-stranded DNA; they are non-enveloped and their capsid contains a "fiber" protein that is analogous in function to the spike glycoproteins of HIV. Latency of the adenovirus can occur in lymphoid tissues. Based on this information, which of the following would be the best type of drug to develop to combat adenoviruses in humans?
A. a combination of drugs that inhibit reverse transcriptase and that binds to fiber protein receptors in human cells
B. a drug that binds to fiber protein receptors in human cells
C. a drug that inhibits reverse transcriptase
D. a combination of drugs that inhibit reverse transcriptase, binds to fiber protein receptors in human cells, and switches off latency
E. a drug that can switch off latency
Answer: B
You might also like to view...
The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification
ATGAAAGCAATTTCCGTACTGAAAGGTTGGTGGCGCACTTCCTGA wild type leader peptide coding sequence ATGAAAGCAATTTCCGTACTGAAAGGTGGGTGGCGCACTTCCTGA mutant leader peptide coding sequence What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type? A. The Trp repressor will bind more tightly to the trp operon in the mutant cells. B. The amount of attenuation will be reduced in the mutant. C. Negative control of the trp operon will be increased in the mutant. D. Open promoter complexes will form less often in the mutant.
What is the most common type of tissue in plants?
a. vascular b. dermal c. meristem d. ground e. cork
The openings in leaves that function to exchange gases are called:
a. cuticles b. stomata c. guard cells d. pits e. pores
Chemical evolution started on Earth
a. after the appearance of prokaryotic cells. b. long before any cells emerged. c. after the appearance of eukaryotic cells. d. after the appearance of eukaryotic cells but before the appearance of multicellular organisms. e. after the appearance of multicellular organisms.