The formula for glucose is C6H12O6 . What is the formula for a polymer made by linking ten glucose molecules together by dehydration synthesis?

A. C60H111O51
B. C60H120O60
C. C60H100O50
D. C60H102O51


D

Biology & Microbiology

You might also like to view...

The scientists responsible for the idea that RNA can act as a catalyst were

A. Watson and Crick. B. Beadle and Tatum. C. Altman and Cech. D. Lederberg and Stanley.

Biology & Microbiology

What percentage of body weight is fluid in healthy adult males and females?

1.30% for both males and females 2.40% for males, 20% for females 3.60% for males, 50% for females 4.65% for males, 30% for females

Biology & Microbiology

Drosophila developmental mutants of ____ genes produce larvae with mirror image segments

a. gap b. pair-rule c. segmentation d. paternal effect e. segment polarity

Biology & Microbiology

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide??Normal gene: ATGGCCGGCCCGAAAGAGACCMutated gene: ATGGCCGGCACCGAAAGAGACC?Normal protein: Met-Ala-Gly-Pro-Lys-Glu-ThrMutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

A. base addition-frameshift B. substitution-nonsense C. base addition-missense D. substitution-missense E. base addition-silent

Biology & Microbiology