The formula for glucose is C6H12O6 . What is the formula for a polymer made by linking ten glucose molecules together by dehydration synthesis?
A. C60H111O51
B. C60H120O60
C. C60H100O50
D. C60H102O51
D
You might also like to view...
The scientists responsible for the idea that RNA can act as a catalyst were
A. Watson and Crick. B. Beadle and Tatum. C. Altman and Cech. D. Lederberg and Stanley.
What percentage of body weight is fluid in healthy adult males and females?
1.30% for both males and females 2.40% for males, 20% for females 3.60% for males, 50% for females 4.65% for males, 30% for females
Drosophila developmental mutants of ____ genes produce larvae with mirror image segments
a. gap b. pair-rule c. segmentation d. paternal effect e. segment polarity
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide??Normal gene: ATGGCCGGCCCGAAAGAGACCMutated gene: ATGGCCGGCACCGAAAGAGACC?Normal protein: Met-Ala-Gly-Pro-Lys-Glu-ThrMutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
A. base addition-frameshift B. substitution-nonsense C. base addition-missense D. substitution-missense E. base addition-silent