The genetic testing procedure associated with in vitro fertilization is ____

a. amniocentesis
b. chorionic villus sample
c. endoscopy
d. preimplantation diagnosis
e. sonography


ANSWER: d

Biology & Microbiology

You might also like to view...

How many amino acids would be included in the polypeptide encoded by the following mRNA:

5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3' A. 7 B. 8 C. 10 D. 13

Biology & Microbiology

Which phase of meiosis is most similar to mitosis, and why?

What will be an ideal response?

Biology & Microbiology

Summer squash plants with the dominant allele C bear white fruit, whereas plants homozygous for the recessive allele c bear colored fruit. Summer squash have a second locus that acts as a modifier gene if the plant is colored. IF the plant is colored and is G-- at the second locus, they will be yellow. If they are colored and gg at the second locus, they will be green. What will the ratio of white to yellow to green squash be in a cross between a double heterozygous plant and a double homozygous recessive plant (CcGg x ccgg)?

a. 4:3:1 b. 2:1:1 c. 9:3:3:1 d. 1:4:6:4:1

Biology & Microbiology

An advantage of cDNA over genomic DNA for cloning genes eukaryotes that are expressible in prokaryotes is that it

a. lacks exons. b. lacks introns. c. contains plasmid DNA. d. does not require a special enzyme for production.

Biology & Microbiology