What physical processes have led to the creation of stone and iron meteorites from carbonaceous chondrite asteroids?
a. collision only
b. differentiation only
c. fragmentation only
d. melting only
e. melting, differentiation, collision, fragmentation
d
You might also like to view...
Some proteins that bind to DNA block transcription, whereas other proteins can activate transcription
Indicate whether the statement is true or false.
The recessive allele that causes phenylketonuria (PKU) is harmful, except when an infant's diet has appropriate levels of the amino acid phenylalanine. What maintains the presence of this harmful allele in a population's gene pool?
A) heterozygote advantage B) stabilizing selection C) diploidy D) balancing selection
Which are the first three amino acids encoded by the wild-type sequence of gene B?
In frogs, green skin is determined by gene B. The wild-type sequence of the 5? end of the RNA-like strand of the entire first exon is shown below. The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5? ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3?
The table of codons is provided here:
A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.
The width of a DNA double helix ____
a. is constant b. is narrower where adenine is present than where cytosine is present c. is wider where purines are present than where pyrimidines are present d. varies randomly e. is wider where pyrimidines are present than where purines are present