What should the tonicity of the distilled water be compared to body cells?
a. It should be isotonic to the cells.
b. It should be hypotonic to the cells.
c. It should be protonic to the cells.
d. It should be hypertonic to the cells.
Ans: b. It should be hypotonic to the cells.
You might also like to view...
Before cell division of somatic cells, each chromosome must be replicated. After replication, the resulting two parts of each chromosome are held together by cohesin at the centromere. These two parts are referred to as:
A. Sister chromatids B. Homologous chromosomes C. Daughter chromosomes D. Kinetochores E. Genes
The rates of evolutionary change in DNA:
A. are highly variable among different gene families. B. are constant in gene families with a diversity of members. C. can only be determined in conserved genes. D. are constant among different gene families and thus are used to estimate the time of divergence. E. are zero.
The human population is currently growing exponentially. Assuming that there is a carrying capacity for humans (Khuman), how would you suggest that the population slow its growth and stabilize at a sustainable number? (Select and defend one or more of the choices listed below.)
a. Increasing death rates through euthanasia. b. Decreasing birth rates through birth control and family planning. c. Increasing Khuman through technological advances. d. Either b or c can be considered correct choices.
You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -GTTAG -3' and 5' -ATCCC -3'. C. 3' -CAATC- 5' and 3' -GCCCT- 5'. D. 5' -CAATC- 3' and 5' -GCCCT- 3'. E. 3' - AGGGC- 5' and 3' -GATTG- 5'.