Which of the following would indicate that administration of a bland water aerosol to a patient with postextubation upper airway edema was having the desired effect?
1. Decreased work of breathing
2. Improved vital signs
3. Decreased stridor or dyspnea
4. Improved O2 saturation
a. 1, 2, and 3 only
b. 1, 2, 3, and 4
c. 3 and 4 only
d. 1, 2, and 4 only
ANS: B
The AARC has published Clinical Practice Guideline: Bland Aerosol Administration. Excerpts are in CPG 38-2.
You might also like to view...
Which of the following job positions is an example of a career in medicine?
A. Surgeons B. Orthodontists C. Family medicine doctors D. Psychiatrists E. All of the above
Which of the following fragments would be generated when the following sequence is cut by SmaI?
5? TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3? A. One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment B. One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment C. Two 19 bp fragments D. One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment
Which are examples of dishonest behaviors? Select all that apply
A) Covering a coworker's shift for him or her B) Overstating your level of education C) Accepting pay for time not worked D) Cheating on a test E) All of the above F) None of the above
Ethambutol may cause optic ____________________, drug fever, hallucinations, and joint pain
Fill in the blank(s) with correct word