Cosmids are so named because they can be used to express foreign genes in a variety of different hosts.
Answer the following statement true (T) or false (F)
False
You might also like to view...
A phospholipid is a _____
A) nonpolar lipid molecule that is made polar by the addition of a phosphate B) nonpolar lipid molecule that is made amphipathic by the addition of a phosphate C) polar lipid molecule that fully interacts with water D) polar lipid molecule that fully repels water
The TCA cycle generates all of the following from each acetyl-CoA molecule oxidized except
A. two ATP or GTP molecules. B. one FADH2 molecule. C. three NADH molecules. D. two CO2 molecules.
Which of these is a method evolved by angiosperms to attract pollinators to their flowers?
A. colorful petals B. scent C. nectar D. All of these are correct.
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide??Normal gene: ATGGCCGGCCCGAAAGAGACCMutated gene: ATGGCCGGCACCGAAAGAGACC?Normal protein: Met-Ala-Gly-Pro-Lys-Glu-ThrMutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
A. base addition-frameshift B. substitution-nonsense C. base addition-missense D. substitution-missense E. base addition-silent