Cosmids are so named because they can be used to express foreign genes in a variety of different hosts.

Answer the following statement true (T) or false (F)


False

Biology & Microbiology

You might also like to view...

A phospholipid is a _____

A) nonpolar lipid molecule that is made polar by the addition of a phosphate B) nonpolar lipid molecule that is made amphipathic by the addition of a phosphate C) polar lipid molecule that fully interacts with water D) polar lipid molecule that fully repels water

Biology & Microbiology

The TCA cycle generates all of the following from each acetyl-CoA molecule oxidized except

A. two ATP or GTP molecules. B. one FADH2 molecule. C. three NADH molecules. D. two CO2 molecules.

Biology & Microbiology

Which of these is a method evolved by angiosperms to attract pollinators to their flowers?

A. colorful petals B. scent C. nectar D. All of these are correct.

Biology & Microbiology

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide??Normal gene: ATGGCCGGCCCGAAAGAGACCMutated gene: ATGGCCGGCACCGAAAGAGACC?Normal protein: Met-Ala-Gly-Pro-Lys-Glu-ThrMutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

A. base addition-frameshift B. substitution-nonsense C. base addition-missense D. substitution-missense E. base addition-silent

Biology & Microbiology