Within a lab, a scientist has two samples-the first is a prion sample, while the second is a viroid sample. But those pesky labels have come off of the flasks! She wants to run a simple analysis to determine which one is which
What type of molecule would she look for to determine which one is which?
A.
Lipids
B. DNA
C.
Protein
D.
Polysaccharides
C
You might also like to view...
The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification
ATGAAAGCAATTTCCGTACTGAAAGGTTGGTGGCGCACTTCCTGA wild type leader peptide coding sequence ATGAAAGCAATTTCCGTACTGAAAGGTGGGTGGCGCACTTCCTGA mutant leader peptide coding sequence What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type? A. The Trp repressor will bind more tightly to the trp operon in the mutant cells. B. The amount of attenuation will be reduced in the mutant. C. Negative control of the trp operon will be increased in the mutant. D. Open promoter complexes will form less often in the mutant.
A unidirectional process where a specific compound released by one organism has a negative effect on another organism is called
A. commensalism. B. negative cooperation. C. predation. D. amensalism.
To mobilize more glucose during fasting,
A. only cortisol will increase. B. only epinephrine will increase. C. only glucagon will increase. D. only glucagon and cortisol will increase. E. cortisol, epinephrine, and glucagon will all increase.
You have isolated a bacterium that grows in a medium containing only inorganic nutrients. Ammonia is oxidized to a nitrate ion. This bacterium is
A) gram-negative. B) using anaerobic respiration. C) a chemoautotroph. D) a photoautotroph. E) a photoheterotroph.