The three main anatomical and functional divisions of the brain are the
A) forebrain, midbrain, hindbrain.
B) frontal, parietal, occipital.
C) cerebellum, medulla oblongata, pons.
D) ventricles, meninges, nerve tracts.
E) hypothalamus, thalamus, pituitary.
A
You might also like to view...
The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification
ATGAAAGCAATTTCCGTACTGAAAGGTTGGTGGCGCACTTCCTGA wild type leader peptide coding sequence ATGAAAGCAATTTCCGTACTGAAAGGTGGGTGGCGCACTTCCTGA mutant leader peptide coding sequence What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type? A. The Trp repressor will bind more tightly to the trp operon in the mutant cells. B. The amount of attenuation will be reduced in the mutant. C. Negative control of the trp operon will be increased in the mutant. D. Open promoter complexes will form less often in the mutant.
The portion of the DNA molecule that is not translated and is a noncoding portion of DNA is
composed of a. introns. b. anticodons. c. exons. d. transcriptions. e. regulatory proteins
Define the term broad-sense heritability (H2). What is implied by a relatively high value of H2? Express aspects of broad-sense heritability in equation form
What will be an ideal response?
A water-vascular system is characteristic of the phylum ____.
A. Nematoda B. Annelida C. Chordata D. Mollusca E. Echinodermata