Meselson and Stahl grew cells in media that contained different isotopes of nitrogen (15N and 14N) so that the DNA molecules produced from these different isotopes could be distinguished by mass
A. Explain how "light" DNA was separated from "heavy" DNA in the Meselson and Stahl experiments.
B. Describe the three existing models for DNA replication when these studies were begun, and explain how one of them was ruled out definitively by the experiment you described for part A.
C. What experimental result eliminated the dispersive model of DNA replication?
A. The DNA samples collected were placed into centrifuge tubes containing cesium chloride. After high-speed centrifugation for 2 days, the heavy and light DNA products were separated by density.
B. The three models were conservative, semiconservative, and dispersive. The conservative model suggested a mechanism by which the original parental strands stayed together after replication and the daughter duplex was made entirely of newly synthesized DNA. The semiconservative model proposed that the two DNA duplexes produced during replication were hybrid molecules, each having one of the parental strands and one of the newly synthesized strands. The dispersive model predicted that the new DNA duplexes each contained segments of parental and daughter strands all along the molecule. The conservative model was ruled out by the density-gradient experiments.
C. The dispersive model was ruled out by using heat to denature the DNA duplexes and then comparing the densities of the single-stranded DNA. If the dispersive model had been correct, individual strands should have had an intermediate density. However, this was not the case; only heavy strands and light strands were observed, which convincingly supported the semiconservative model for DNA replication.
You might also like to view...
Which of the following specialized structures/inclusions would aquatic photoautotrophic bacteria likely possess?
1. Thylakoids 2. PHB Granules 3. Carboxysomes 4. Gas vacuoles 5. Chloroplasts
Pore in plasma membrane that allows water movement.
Choose the letter of the best match: A. abscisic acid B. trichomes C. aquaporin D. endodermis E. stoma
Which of the following only occrus in mitosis and NOT during meiosis II?
A) Synapsis and crossing over B) Haploid chromosomes line up at the equator C) Nuclei congaing the diploid number of chromosomes D) Four haploid daughter cells result
You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -GTTAG -3' and 5' -ATCCC -3'. C. 3' -CAATC- 5' and 3' -GCCCT- 5'. D. 5' -CAATC- 3' and 5' -GCCCT- 3'. E. 3' - AGGGC- 5' and 3' -GATTG- 5'.