What is the organ in animals without teeth such as
earthworms and birds that accomplishes the same
action as teeth?
a. beak
b. pharynx
c. gizzard
d. cloaca
e. crop
Answer: c
You might also like to view...
Which of the following sequences in double-stranded DNA is most likely to be recognized as a cutting site for a restriction enzyme (endonuclease)?
A) AAGG TTCC B) AGTC TCAG C) GGCC CCGG D) ACCA TGGT E) AAAA TTTT
Microbes that live on the surface of plants are called ________ .
Fill in the blank(s) with the appropriate word(s).
What does the following formula represent? dN1/dt = r1N1(1 - (N1 + N2)/K1)
A) population growth of species 1 in absence of species 2 B) population growth of species 1 in presence of species 2 C) carrying capacity of species 1 in absence of species 2 D) population size in the presence of species 2
You have the target DNA and primers shown below. You add the target DNA and primers, along with dATP, dTTP, dGTP, dCTP and Taq DNA polymerase to a test tube. After 30 cycles of PCR, which of the following is true about the DNA in your test tube?Target DNA: 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'Primer 1: 5' - GATCAA - 3'Primer 2: 5' - CGGAAA - 3'
A. There will be around a billion DNA molecules and most will look just like the template 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. B. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'. C. Only the template and primers will be present; since no DNA helicase was added the strands won't separate so no new DNA can be made. D. There will be around a billion DNA molecules and most will be single stranded, either 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' OR 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. E. There will be around a million DNA molecules of various sizes, depending on where chain termination occurred.