A 25- year-old female is in kidney failure and needs a transplant. She is A positive and HLA A1A3/B5B7/C2C9/DR4DR8. Which of the following donors would be the best match?
A) her brother, who is B positive and HLA A1A3/B7B5/C2C9/DR8DR4
B) her sister, who is A positive and HLA A3A4/B7B9/C2C3/DR4DR7
C) her mother, who is AB positive and HLA A1A4/B9B5/C9C3/DR8DR7
D) an unrelated donor who is A positive and HLA A6A3/B5B7/C3C10/DR2DR9
Ans: B) her sister, who is A positive and HLA A3A4/B7B9/C2C3/DR4DR7
You might also like to view...
Tortoiseshell cats have a coat-color gene on their X chromosome. What process in eukaryotes explains why males can have solid orange or black fur, and only females can have the tortoiseshell pattern of fur?
What will be an ideal response?
In order for a population to meet the conditions of the Hardy-Weinberg predictions, it must:a
have only moderate migration in and out of the population. b. have no natural selection. c. have only occasional matings determined by humans. d. have mating between relatives. e. not be very large.
You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -GTTAG -3' and 5' -ATCCC -3'. C. 3' -CAATC- 5' and 3' -GCCCT- 5'. D. 5' -CAATC- 3' and 5' -GCCCT- 3'. E. 3' - AGGGC- 5' and 3' -GATTG- 5'.
A vascular bundle
A. is not found in leaves. B. is usually scattered in the stem of a eudicot. C. contains xylem and phloem. D. is very distinct in the apical meristem. E. is on the outer surface of a root.