Secondary succession is likely to occur in a(n) ____

a. burned forest only
b. shallow lake only
c. abandoned field only
d. burned forest and an abandoned field
e. burned forest, a shallow lake, and an abandoned field


ANSWER: d

Biology & Microbiology

You might also like to view...

Identifying proteases being essential for replication of a virus would suggest the virus

A) lyses its host following genome replication. B) contains at least one polyprotein. C) has a single-stranded RNA genome. D) uses at least one set of overlapping genes.

Biology & Microbiology

True or False: Various species of Anolis lizards are able to coexist in Hispaniola because they function in different niches (e.g., feed on different organisms or hunt in different areas)

A. true B. false

Biology & Microbiology

Thus far no evidence has been found that nonionizing radiation, such as the energy given off by cell phones, causes cancer.

Answer the following statement true (T) or false (F)

Biology & Microbiology

You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'

A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -GTTAG -3' and 5' -ATCCC -3'. C. 3' -CAATC- 5'  and 3' -GCCCT- 5'. D. 5' -CAATC- 3' and 5' -GCCCT- 3'. E. 3' - AGGGC- 5' and 3' -GATTG- 5'.

Biology & Microbiology