In an ionic bond,
A. two atoms are attracted by partial positive and negative charges.
B. two atoms are attracted by the same charges.
C. atoms attract each other by sharing electrons to fill their valence shells.
D. atoms, having gained or lost electrons, attract one another with opposite charges.
E. two atoms both become strongly electronegative and attract each other.
D. atoms, having gained or lost electrons, attract one another with opposite charges.
You might also like to view...
In the flower diagram shown above, the item labeled "8" is a(n)
a. ovule. b. stigma. c. sepal. d. anther. e. style.
The sequence of gene B from another baby frog who is homozygous for allele b2 is shown. What effect does the mutation in allele b2 have on the protein?
5? AGGTCGCATAAATGTTCCTGTAATTTGG… 3? A) Allele b2 has a frameshift mutation—a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on. B) Allele b2 has a deletion of one nucleotide outside of the coding region and there is no effect on the protein. C) Allele b2 has a missense mutation—a nucleotide substitution that changes one amino acid to another. D) Allele b2 has a nonsense mutation—a nucleotide substitution that forms a stop codon. E) Allele b2 has a silent mutation—a nucleotide substitution that does not change the protein.
A broad land or aquatic region characterized by climate, geography, and the species found within them is called ____
a. an ecoregion b. a hot spot c. a realm d. a habitat island e. the biosphere
For the first few days after birth, the mammary glands produce a pale fluid rich in proteins, antibodies,
minerals and vitamin A known as a. lanugo. b. meconium. c. colostrum. d. surfactant. e. premilk.