If three consecutive bases in DNA are ATC, what is the corresponding codon?
a. UUG
b. TAC
c. ATC
d. TAG
e. UAG
ANSWER: e
You might also like to view...
Determining the average propensity of customers to purchase a warranty plan, if the plan is under a promotional offer during the time of product purchase, would be an example of what type of information?
A. Passive prediction B. Indirect causal effect C. Lead information D. Lag information
Considering the evolution of Bacteria, the criteria used for taxonomy, and the genetic requirements for individual metabolic pathways,
explain how it is unlikely to observe three genera of the same family where one genus has strict anaerobes that degrade only small aromatics, another genus degrades large molecular weight sugars aerobically, and a third is a photoautotroph. What will be an ideal response?
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition - silent B. substitution - missense C. base addition - missense D. substitution - nonsense E. base addition-frameshift
The condition of the fire ant in the above photograph
is caused by a. biological control with phorid flies. b. pesticides. c. wholesale physical destruction of their mounds. d. herbicides. e. all of these.