Which sphincter, when it relaxes, allows bile to flow into the duodenum?
a. Pyloric sphincter
b. Sphincter of Oddi
c. Ampulla of Vater
d. Ileocecal valve
ANS: B
When the sphincter of Oddi relaxes, bile flows into the duodenum. The pyloric sphincter controls flow of fluid from the stomach to the duodenum. Secretions from the pancreas empty into the common bile duct at the ampulla of Vater. The ileocecal valve prevents reflux of digested mate-rial from the colon into the small intestine.
You might also like to view...
Defibrillation must occur within one minute.
Answer the following statement true (T) or false (F)
Which of the following fragments would be generated when the following sequence is cut by SmaI?
5? TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3? A. One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment B. One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment C. Two 19 bp fragments D. One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment
Which of these layers of the heart wall contains Purkinje fibers?
A. Epicardium B. Myocardium C. Endocardium D. Pericardium E. Pericardial cavity
Select the word that is spelled correctly
A) ?bronchal B) ?bronchial C) ?bronkial D) ?branchiol