The phylum that includes snails, clams, oysters, and octopuses is the 

A. Ectoprocta.
B. Brachiopoda.
C. Mollusca.
D. Annelida.
E. Phoronida.


C. Mollusca.

Biology & Microbiology

You might also like to view...

Which of the following is correct about members of the genus Propionibacterium?

A. They cause acne vulgaris and contribute to the development of body odor. B. They are typically found growing on the skin and in the digestive tract of animals. C. They are used in the production of Swiss cheese. D. All of the choices are correct.

Biology & Microbiology

Which one of the following sequences is most likely to form a hairpin with a 5 nucleotide loop?

A. TTTTAGACTGAAATAGTCTTTTT B. TACGAAATACGGGATTTA C. AAAAAAAATTTTTTT D. CCCGGGAAAAAAAAACCCGGG E. ACATACAGACCCAATTGACATAG

Biology & Microbiology

If a stretch of human double stranded DNA contains 47% G and C bases, then ____

a. it contains 47% A and T bases b. there are more pyrimidines than purines c. there are more purines than pyrimidines d. it contains 53% A and T bases

e. there are no genes in this stretch of DNA

Biology & Microbiology

The niche of an earthworm in an ecosystem is

a. a producer. b. a consumer. c. a detritivore. d. a decomposer. e. more than one of these.

Biology & Microbiology