Which of the following types of bacterial cells would have only a single flagellum?
a. Amphitrichous
b. Monotrichous
c. Peritrichous
d. Lophotrichous
e. Lophotrichous and monotrichous
Ans: b. Monotrichous
You might also like to view...
During a vasectomy, which structure is cut?
a. epididymis b. prostate c. seminiferous tubules d. seminal vesicles e. vas deferens
Complex traits are usually quantified by ____________________ rather than by ____________________.Fill in the blank(s) with the appropriate word(s)
Which description best supports the endosymbiotic theory of organelles?
A. Eukaryotic cells acquired mitochondria and plastids by engulfing free-living bacteria and developed a symbiotic relationship with them. Mitochondria were derived from aerobic bacterium while chloroplasts were derived from cyanobacterium. B. Eukaryotic cells acquired mitochondria and flagella by engulfing free-living bacteria and developed a symbiotic relationship with them. Mitochondria were derived from aerobic bacterium while flagella were derived from motile bacteria. C. Eukaryotic cells acquired mitochondria and plastids by engulfing free-living bacteria and developed a symbiotic relationship with them. Mitochondria were derived from anaerobic bacterium while chloroplasts were derived from aerobic bacterium. D. Eukaryotic cells acquired nuclei and flagella by engulfing free-living bacteria and developed a symbiotic relationship with them. Nuclei were derived from aerobic bacterium while flagella were derived from motile bacteria.
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide??Normal gene: ATGGCCGGCCCGAAAGAGACCMutated gene: ATGGCCGGCACCGAAAGAGACC?Normal protein: Met-Ala-Gly-Pro-Lys-Glu-ThrMutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
A. base addition-frameshift B. substitution-nonsense C. base addition-missense D. substitution-missense E. base addition-silent