Which of the following types of bacterial cells would have only a single flagellum?

a. Amphitrichous
b. Monotrichous
c. Peritrichous
d. Lophotrichous
e. Lophotrichous and monotrichous


Ans: b. Monotrichous

Biology & Microbiology

You might also like to view...

During a vasectomy, which structure is cut?

a. epididymis b. prostate c. seminiferous tubules d. seminal vesicles e. vas deferens

Biology & Microbiology

Complex traits are usually quantified by ____________________ rather than by ____________________.Fill in the blank(s) with the appropriate word(s)

Biology & Microbiology

Which description best supports the endosymbiotic theory of organelles?

A. Eukaryotic cells acquired mitochondria and plastids by engulfing free-living bacteria and developed a symbiotic relationship with them. Mitochondria were derived from aerobic bacterium while chloroplasts were derived from cyanobacterium. B. Eukaryotic cells acquired mitochondria and flagella by engulfing free-living bacteria and developed a symbiotic relationship with them. Mitochondria were derived from aerobic bacterium while flagella were derived from motile bacteria. C. Eukaryotic cells acquired mitochondria and plastids by engulfing free-living bacteria and developed a symbiotic relationship with them. Mitochondria were derived from anaerobic bacterium while chloroplasts were derived from aerobic bacterium. D. Eukaryotic cells acquired nuclei and flagella by engulfing free-living bacteria and developed a symbiotic relationship with them. Nuclei were derived from aerobic bacterium while flagella were derived from motile bacteria.

Biology & Microbiology

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide??Normal gene: ATGGCCGGCCCGAAAGAGACCMutated gene: ATGGCCGGCACCGAAAGAGACC?Normal protein: Met-Ala-Gly-Pro-Lys-Glu-ThrMutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

A. base addition-frameshift B. substitution-nonsense C. base addition-missense D. substitution-missense E. base addition-silent

Biology & Microbiology