Some forms of methylmalonic acidemia can be ____
a. caused by ethylene glycol exposure
b. caused by tainted baby formula
c. caused by type O blood transfusions
d. cured if the condition is detected early in life
e. treated successfully if the condition is detected early in life
ANSWER: e
You might also like to view...
A ______________ group consists of the most recent common ancestor and some of its descendants.
Fill in the blank(s) with the appropriate word(s).
Method of measuring microbial growth is used for samples with high cell numbers, requires incubation, and gives a viable cell count
What will be an ideal response?
The (brain/heart/liver) is the organ most severely damaged by Trypanosoma cruzi.
Fill in the blank(s) with the appropriate word(s).
You have the target DNA and primers shown below. You add the target DNA and primers, along with dATP, dTTP, dGTP, dCTP and Taq DNA polymerase to a test tube. After 30 cycles of PCR, which of the following is true about the DNA in your test tube?Target DNA: 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'Primer 1: 5' - GATCAA - 3'Primer 2: 5' - CGGAAA - 3'
A. There will be around a billion DNA molecules and most will look just like the template 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. B. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'. C. Only the template and primers will be present; since no DNA helicase was added the strands won't separate so no new DNA can be made. D. There will be around a billion DNA molecules and most will be single stranded, either 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' OR 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. E. There will be around a million DNA molecules of various sizes, depending on where chain termination occurred.