Some forms of methylmalonic acidemia can be ____

a. caused by ethylene glycol exposure
b. caused by tainted baby formula
c. caused by type O blood transfusions
d. cured if the condition is detected early in life
e. treated successfully if the condition is detected early in life


ANSWER: e

Biology & Microbiology

You might also like to view...

A ______________ group consists of the most recent common ancestor and some of its descendants. 

Fill in the blank(s) with the appropriate word(s).

Biology & Microbiology

Method of measuring microbial growth is used for samples with high cell numbers, requires incubation, and gives a viable cell count

What will be an ideal response?

Biology & Microbiology

The (brain/heart/liver) is the organ most severely damaged by Trypanosoma cruzi.

Fill in the blank(s) with the appropriate word(s).

Biology & Microbiology

You have the target DNA and primers shown below. You add the target DNA and primers, along with dATP, dTTP, dGTP, dCTP and Taq DNA polymerase to a test tube. After 30 cycles of PCR, which of the following is true about the DNA in your test tube?Target DNA:        5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'Primer 1:                5' -  GATCAA - 3'Primer 2:                5' -  CGGAAA - 3'

A. There will be around a billion DNA molecules and most will look just like the template 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. B. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'. C. Only the template and primers will be present; since no DNA helicase was added the strands won't separate so no new DNA can be made. D. There will be around a billion DNA molecules and most will be single stranded, either 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'  OR 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'.  E. There will be around a million DNA molecules of various sizes, depending on where chain termination occurred.

Biology & Microbiology