The strongest chemical bonds are

A. hydrogen bonds.
B. Van der Waal forces.
C. hydrophobic interactions.
D. ionic bonds.
E. covalent bonds.


E. covalent bonds.

Biology & Microbiology

You might also like to view...

The Limulus amebocyte lysate assay is used to detect endotoxin in clinical samples such as serum or cerebrospinal fluid

Indicate whether the statement is true or false.

Biology & Microbiology

If flipping two coins, what is the probability that both will land on “heads”?

a. 1/2 b. zero c. 1/4 d. 1/8

Biology & Microbiology

A pathogen is limited to only the host cells that contain a specific _____ molecule for binding to its surface molecules

Fill in the blank(s) with the appropriate word(s).

Biology & Microbiology

You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'

A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -GTTAG -3' and 5' -ATCCC -3'. C. 3' -CAATC- 5'  and 3' -GCCCT- 5'. D. 5' -CAATC- 3' and 5' -GCCCT- 3'. E. 3' - AGGGC- 5' and 3' -GATTG- 5'.

Biology & Microbiology