Flexible bacteria with a helical shape are called
A. coccobacilli.
B. spirilla.
C. spirochetes.
D. vibrios.
Answer: C
You might also like to view...
About 450 million years ago, the terrestrial landscape on Earth would have _____
A) looked very similar to that of today, with flowers, grasses, shrubs, and trees B) been completely bare rock, with little pools that contained bacteria and cyanobacteria C) been covered with tall forests in swamps that became today's coal D) had non-vascular green plants similar to liverworts forming green mats on rock
The sequence of gene B from another baby frog who is homozygous for allele b2 is shown. What effect does the mutation in allele b2 have on the protein?
5? AGGTCGCATAAATGTTCCTGTAATTTGG… 3? A) Allele b2 has a frameshift mutation—a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on. B) Allele b2 has a deletion of one nucleotide outside of the coding region and there is no effect on the protein. C) Allele b2 has a missense mutation—a nucleotide substitution that changes one amino acid to another. D) Allele b2 has a nonsense mutation—a nucleotide substitution that forms a stop codon. E) Allele b2 has a silent mutation—a nucleotide substitution that does not change the protein.
Mitosis is the process by which a cell divides to produce two daughter cells. During which phase of mitosis do the sister chromatids separate?
a. prophase b. prometaphase c. metaphase d. anaphase e. telophase
The water balance problem of plants living in salty soil is the result of:
a. water moving out of plant roots by osmosis. b. extensive leaching. c. a low soil pH. d. low concentrations of micronutrients. e. excessive run off