DNA vaccines are dangerous due to the possibility of the DNA causing reversion in the inactivated pathogen
Indicate whether this statement is true or false.
FALSE
You might also like to view...
The group that probably gave rise to chloroplasts is the
A. cyanobacteria. B. green photosynthetic bacteria. C. purple sulfur bacteria. D. non-sulfur purple bacteria. E. methane bacteria.
Plants that rely on ants to disperse their seeds have an ant-attracting food body on the seed coat referred to as a(n) ________
Fill in the blank(s) with correct word
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
A) 0 times B) 1 time C) 2 times D) 3 times
Which of the following is true for restriction enzymes?
A. A given restriction enzyme will always recognize the same DNA sequence, but it will cut differently depending on the species of origin of the DNA. B. Each restriction enzyme known is able to make a staggered cut at its recognition site. C. Any restriction enzyme can cut any piece of DNA. D. A different restriction enzyme must be used to open the vector DNA than to excise the gene sequence to be cloned. E. Restriction enzymes are useful in genetic engineering when they make staggered cuts in DNA