You want to design a DNA probe used for hybridization to isolate a clone from a cDNA library. Which of the following statements about DNA probes is true?
(a) The shorter the DNA probe used to probe the library, the greater the number of colonies to which the probe might hybridize.
(b) A DNA probe that contains sequences that span two exons is better suited to the purpose than a DNA probe that only contains sequences from one exon.
(c) A DNA probe that contains sequences immediately upstream of the DNA that codes for the first methionine in the open reading frame will usually not hybridize to clones in a cDNA library.
(d) Hybridization of a DNA probe to the plasmid of interest will permit the detection of the clone of interest; labeling of the DNA probe is not necessary.
(a) The shorter the DNA probe, the more likely it is that that particular sequence will show up in the genome at random. cDNA libraries contain sequences represented by exons, so it does not really matter whether or not the probe spans two exons [choice (b)]. mRNAs usually have 5? untranslated regions that should be represented in a cDNA library, so choice (c) is not true. DNA probes are usually labeled (for example, with radioactivity) for visualization [choice (d)].
You might also like to view...
In the context of the influenza virus, describe the mechanistic difference between an antigenic drift and an antigenic shift. Also indicate the result of each
What will be an ideal response?
Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred?
Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition-silent B. base addition-none C. base addition-missense D. base addition-nonsense E. base addition-frameshift
Parasitoids reduce the host population by ________
a. having their larvae steal the host's nutrients and eventually killing the host during larval development b. outcompeting the host population for breeding sites and eventually killing the host during larval development c. killing the host's offspring and outcompeting the host population for breeding sites d. having larvae steal the host's nutrients and making the host sterile e. having the larvae steal the host's nutrients and killing the host's offspring
Which of the following is occurring because of
the warming trend we are currently in?
a. birds are laying eggs earlier b. plants are flowering earlier c. mammals are hibernating for shorter periods d. the rate of extinctions is increasing e. all of these are occurring